Question bank › Hashing
Dsa Hashing Hard

Repeated DNA Sequences

A DNA sequence is represented by a string consisting of the characters 'A', 'C', 'G', and 'T'. Your task is to find all 10-letter-long sequences (substrings) that occur more than once in a given DNA molecule string. Return them in any order. Input Format: - A single line containing the DNA string (1 <= length <= 10000). Output Format: - Print each repeating sequence of 10 letters on a new line. Example: Input: AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT Output: AAAAAAAAAA CCCCCCCCAA

Key concepts

hashingstringscounting

Practise this out loud — free

Start a mock interview on THIS exact question — a voice AI interviewer opens with it, pushes back like a real onsite, then hands you an instant scorecard.

🎙 Practise this question now
Part of Praxari's verified interview question bank. We show the prompt and concepts to practise with — never a copy-paste solution.